Genetically identified Calanus finmarchicus and Calanus glacialis in Svalbard waters with size and antenna pigmentation

Отбор проб Наблюдение
Последняя версия опубликовано The University Centre in Svalbard июн. 5, 2026 The University Centre in Svalbard
Дата публикации:
5 июня 2026 г.
Опубликовано:
The University Centre in Svalbard
Лицензия:
CC-BY 4.0

Скачайте последнюю версию данных этого ресурса в формате Darwin Core Archive (DwC-A) или метаданных ресурса в форматах EML или RTF:

Данные в формате DwC-A Скачать 32 Записи в English (503 KB) - Частота обновления: неизвестно
Метаданные в формате EML Скачать в English (23 KB)
Метаданные в формате RTF Скачать в English (20 KB)

Описание

The dataset contains genetically identified Calanus finmarchicus and Calanus glacialis in Svalbard, sampled from March 2024 to February 2025. Monthly samples were conducted in Isfjorden, and seasonally in Kongsfjorden (April, June, September, January) and Billlefjorden (June, September, October), and in addition one-time samples collected in Rijpfjorden and Wijdefjorden. The dataset contains data on all copepodite stages (CI to adult male/female) of both species, with size measurements, lipid sack area, dry weight (mg) and antenna pigmentation (3 categories (0%, <50%, >50%)) of each individual.

Записи данных

Данные этого событие отбора проб ресурса были опубликованы в виде Darwin Core Archive (DwC-A), который является стандартным форматом для обмена данными о биоразнообразии в виде набора из одной или нескольких таблиц. Основная таблица данных содержит 32 записей.

Также в наличии 3 таблиц с данными расширений. Записи расширений содержат дополнительную информацию об основной записи. Число записей в каждой таблице данных расширения показано ниже.

Event (core)
32
ExtendedMeasurementOrFact 
9891
Multimedia 
2439
Occurrence 
2439

Данный экземпляр IPT архивирует данные и таким образом служит хранилищем данных. Данные и метаданные ресурсов доступны для скачивания в разделе Загрузки. В таблице версий перечислены другие версии ресурса, которые были доступны публично, что позволяет отслеживать изменения, внесенные в ресурс с течением времени.

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Skjæveland B H, Søreide J E (2026). Genetically identified Calanus finmarchicus and Calanus glacialis in Svalbard waters with size and antenna pigmentation. Version 1.3. The University Centre in Svalbard. Samplingevent dataset. https://ipt.gbif.no/resource?r=svalbard_calanus_2024_2025&v=1.3

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является The University Centre in Svalbard. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: 77ceaca9-5678-43ab-b805-c0bab95cd69d.  The University Centre in Svalbard отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке GBIF Norway.

Ключевые слова

Samplingevent; Observation

Контакты

Bergfrid Høgås Skjæveland
  • Metadata Provider
  • Originator
  • Point Of Contact
The University Centre in Svalbard
  • P.O. Box 156
9171 Longyearbyen
NO
Janne E. Søreide
  • Metadata Provider
  • Originator
  • Point Of Contact
  • Principal Investigator
The University Centre in Svalbard
  • P.O. Box 156
9171 Longyearbyen
NO
Malin Daase
  • Content Provider
The University Centre in Svalbard
  • P.O. Box 156
9171 Longyearbyen
NO

Географический охват

Samples were taken in fjords in Western and Northern Svalbard. Station IsK in Isfjorden (78.32N 15.16E) is the main station with monthly samples. Seasonal samples were taken at station KB3 in Kongsfjorden (78.95N 11.93E) and BAB in Billefjorden (78.65N 16.67N), as well as one time samples taken at R3 in Rijpfjorden (80.26N 22.29E), WF in Wijdefjorden (79.12N 16.04E) and on the Shelf west of Svalbard (79.55N 9.58E)

Ограничивающие координаты Юг Запад [78,129, 9,586], Север Восток [80,266, 22,29]

Таксономический охват

All Calanus finmarchicus and Calanus glacialis were identified to species genetically.

Species Calanus finmarchicus, Calanus glacialis

Временной охват

Дата начала / Дата окончания 2024-03-12 / 2025-02-18

Методы сбора

Calanus were collected with a bongo net (180µm mesh size, 2x 0.2728m2 opening) from the whole water column. In cases of bad weather and the need for manual labour to pull the net, a WP2 net (200µm mesh size, 0.25m2 opening) was used instead. In September samples were taken with a bongo net from the upper 50 meters, and the deepest 50-125 meters with a closing WP2-net (60µm mesh size, 0.25m2 opening) instead of the whole water column. Additional females were collected from 50-0 meters in April, May and June for egg incubation.

Охват исследования Both Arctic and warmer Atlantic water is transported along the western side of Svalbard and advected into the fjords, and the fjords Isfjorden (station IsK, IsA and IsG), Kongsfjorden (KB3) and Wijdefjorden (WF) typically has Atlantic Water masses present. Billefjorden (BAB) is located behind a sill in Isfjorden that prevents Atlantic water from entering, resulting in subzero water at the bottom all year round and sea ice cover in the winter. Rijpfjorden (R3) also has Arctic conditions with a long ice-cover and subzero temperatures. The Shelf station is located in the core of the Atlantic water being transported along western Svalbard. Station IsK has been sampled monthly throughout the yearlong field campaign and BAB and KB3 were sampled seasonally. The other stations were only sampled once.

Описание этапа методики:

  1. Photographing Calanus spp.: The samples with live Calanus spp. were filtered down to a known volume and then sub samples were taken with a stempel pipette. Each individual Calanus spp. from the subsample was picked out with a plastic pipette and placed individually on the inside of the lid of a 24 multi-vial tray. They were then photographed in lateral view and were forced into this position by removing some of the water surrounding it with a glass pipette. The pictures were taken with a Leica MC170 HD camera (Leica Microsystems) attached to a Leica MZ16, MZ9.5 or M205 C stereo microscope (Leica Microsystems) through the software LAS EZ, or LAS 4.6 (Leica Microsystems) for the Leica M205 C stereo microscope. The developmental stage was identified. Then the Calanus spp. were picked up with a pair of soft tweezers and dipped in distilled water and placed in either a pre-weighed tin cup in a flat bottomed 96-well plate or directly in 96-well PCR plate. When the work was finished and during breaks, the 96-well plates were frozen at -20∘C, and the samples were kept cold while working. To have a bigger non-quantitative dataset on the measurements for some developmental stages extra individuals were picked out, photographed and frozen.
  2. Description of measurements taken: The individuals in tin cups were later freeze-dried in a FreeZone Benchtop Freeze Dryer, for approximately 24 hours. They were then put in a desiccator for at least one hour, and then every cup was weighed on a Microbalance XPR scale (accuracy ±0.5 μg) to give the dry weight of each individual copepod. The tin cups had been pre-weighted on the same scale. The computer program IMAGEJ (Schneider et al., 2012) was used to measure the area of the lipid sack and the prosome, and the prosome length. The areas were calculated by the program after drawing around the outline of the prosome and lipid sack with a drawing board (Intuos Pen and Touch Medium Tablet (CTH680), Wacom). The length was measured by drawing a line from the anterior to the posterior end of the prosome. IMAGEJ measures the numbers of pixels within the area or along the line. Before measuring, this was calibrated with a picture of a calibration slide, so the ratio for the number of pixels per mm was known. Because of the size variation between the different developmental stages, the pictures were taken on different magnifications on the microscopes, and a picture of the calibration slide was taken for each magnification used. The pictures have been taken with several combinations of microscopes and computers, and have different qualities, and therefore different numbers of pixels. For each sample new pictures of the calibration slide were taken. The degree of antenna pigmentation is given in three categories based on the percentage of redness on the antenna. The categories are “0% pigmentation, “<50% pigmentation” and “>50% pigmentation”.
  3. Genetic species identification: The species identity of C. finmarchicus and C. glacialis was determined genetically. DNA was extracted using the HotSHOT-method (Montero-Pau et al., 2008), modified for working on Calanus. One copepod was added to each well of a 96 well PCR plate. To each well 100 μL of Lysis buffer (25 mM NaOH, 0.2 mM Na2EDTA) was added, before covering the plate with PCR strip caps, and incubating it in a PCR machine (Mastercycler X50s, Eppendorf) for 1 hour at 95 ∘C. After cooling down the plate for five to ten minutes, 100 μL of Neutralization solution (40 mM Trizma hydrochloride (Sigma-Aldrich)) was added to each well, and the plate was briefly centrifuged (Centrifuge 5804, Eppendorf) at 1000 rpm to make sure all material was at the bottom of the well. Lysis buffer and Neutralization solution were in addition added to a well without a copepod as a negative control for the DNA extraction. In cases where the copepod had first been placed in a tin cup for weighing, each individual was moved using soft tweezers that was cleaned with 10% sodium hypochlorite (NaOCl, household bleach) between every single copepod to avoid cross-contamination. The tweezers were wet after being rinsed off with Milli-Q water, and the lysis buffer was already added to the well of the PCR-plate, so the copepod easily let go of the tweezers when being put in the well. 75 μL of Lysis buffer and Neutralization solution was added to wells containing a copepod of developmental stage CI - CIII to ensure high enough concentration of DNA. A master mix containing everything except the DNA sample was made to keep PCR conditions consistent between reactions. The master mix was pipetted into each well of a 96 well PCR plate prior to adding DNA or controls. Each reaction contained 1.085 μL Milli-Q Water, 0.06 μL Forward Primer, (G-150F, GACGCCATTGACCATCCAGT, 10 μM), 0.06 μL Reverse Primer (G-150R, GCTCCAGCGGTTAGGTTTCT, 10 μM), 2.5 μL AccuStart II PCR ToughMix (Quantabio), 0.025 μL 6x Orange DNA loading dye (Thermo Scientific), 0.02 μL MgCl2 (25mM, Roche), and 1.25 μL of extracted DNA. The process was controlled by the incorporation of positive and negative controls during every PCR amplification. DNA from a C. finmarchicus and C. glacialis (1.25 μL each) was added as positive PCR controls, while 1.25 μL Milli-Q water was used as a negative PCR control. An extraction blank, 1.25 μL of Lysis buffer and Neutralization solution mix, was used as negative control for the DNA extraction. After covering the plate with adhesive film or PCR strip caps and giving it a quick spin in the plate centrifuge to make sure all the liquid was collected at the bottom of the well. PCR was carried out in the PCR machine. First, the program ran 2 minutes at 94°C, then 35 cycles of 10 seconds at 94°C, 10 seconds at 55°C and 10 seconds at 72°C, and finally 5 minutes at 72°C. The products were kept cool at 10°C in the machine until collection. The PCR-products were analysed by gel electrophoresis on a 2% gel in 1X TAE buffer stained with 3.5 μL of GelRed Nucleic Acid Stain (Biotium). In the first and last well of each row 2μL DNA ladder (GeneRuler Low Range DNA Ladder, Thermo Scientific or MassRuler Low Range DNA Ladder, Thermo Scientific) was added. The second well of each row had 1.5 μL positive control, either C. finmarchicus or C. glacialis. In the remaining wells I added 2 μL of the PCR-products or the negative controls. The gel ran for 20 minutes at 220 V, before photographing the gel under UV-light (NuGenius, Syngene), to see the position of the DNA-bands in the gel. The expected amplicon size using G-150F and G-150R primers is 131 base pairs for C. finmarchicus and 161 base pairs for C. glacialis (Smolina et al., 2014), allowing clear discrimination of the two species on a 2% agarose gel.
  4. Measuring egg production rate: The live samples from the upper 50 meters sampled in April and May were used for capturing females for incubation to measure egg production rate. At IsK in mid-June the sample taken from the whole water column was used, due to the net being pulled by manual labour. The female Calanus were placed individually in their own egg incubation chambers. The chambers consisted of two plastic cups stacked into each other, where the upper one had the bottom replaced with a mesh, with empty space below. If the females laid eggs, the eggs would sink and pass through the mesh, avoiding predation by the female. The chambers were filled with filtered sea water and a lid was loosely placed on top. Temperatures were as close to in situ as possible. The females were in the egg incubation chambers for 24 hours and were then removed. They were then photographed and placed in tin cups for weighing and genetic identification like mentioned above. The eggs within each cup were counted.

Библиографические ссылки

  1. Montero-Pau, Javier, Africa Gómez, and Joaquín Muñoz. 2008. ‘Application of an Inexpensive and High-Throughput Genomic DNA Extraction Method for the Molecular Ecology of Zooplanktonic Diapausing Eggs’. Limnology and Oceanography: Methods 6 (6): 218–22. https://doi.org/10.4319/lom.2008.6.218. https://doi.org/10.4319/lom.2008.6.218.
  2. Schneider, Caroline A., Wayne S. Rasband, and Kevin W. Eliceiri. 2012. ‘NIH Image to ImageJ: 25 Years of Image Analysis’. Nature Methods 9 (7): 671–75. https://doi.org/10.1038/nmeth.2089. https://doi.org/10.1038/nmeth.2089.
  3. Smolina, I., S. Kollias, M. Poortvliet, et al. 2014. ‘Genome- and Transcriptome-Assisted Development of Nuclear Insertion/Deletion Markers for Calanus Species (Copepoda: Calanoida) Identification’. Molecular Ecology Resources 14 (5): 1072–79. https://doi.org/10.1111/1755-0998.12241. https://doi.org/10.1111/1755-0998.12241.

Дополнительные метаданные

Благодарности
Альтернативные идентификаторы 77ceaca9-5678-43ab-b805-c0bab95cd69d
https://ipt.gbif.no/resource?r=svalbard_calanus_2024_2025