Genetically identified Calanus finmarchicus and Calanus glacialis in Svalbard waters with size and antenna pigmentation

Registros

Los datos en este recurso de evento de muestreo han sido publicados como Archivo Darwin Core(DwC-A), el cual es un formato estándar para compartir datos de biodiversidad como un conjunto de una o más tablas de datos. La tabla de datos del core contiene 32 registros.

también existen 3 tablas de datos de extensiones. Un registro en una extensión provee información adicional sobre un registro en el core. El número de registros en cada tabla de datos de la extensión se ilustra a continuación.

Este IPT archiva los datos y, por lo tanto, sirve como repositorio de datos. Los datos y los metadatos del recurso están disponibles para su descarga en la sección descargas. La tabla versiones enumera otras versiones del recurso que se han puesto a disposición del público y permite seguir los cambios realizados en el recurso a lo largo del tiempo.

Versiones

La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.

¿Cómo referenciar?

Los usuarios deben citar este trabajo de la siguiente manera:

Skjæveland B H, Søreide J E (2026). Genetically identified Calanus finmarchicus and Calanus glacialis in Svalbard waters with size and antenna pigmentation. Version 1.3. The University Centre in Svalbard. Samplingevent dataset. https://ipt.gbif.no/resource?r=svalbard_calanus_2024_2025&v=1.3

Derechos

Los usuarios deben respetar los siguientes derechos de uso:

El publicador y propietario de los derechos de este trabajo es The University Centre in Svalbard. Esta obra está bajo una licencia Creative Commons de Atribución/Reconocimiento (CC-BY 4.0).

Registro GBIF

Este recurso ha sido registrado en GBIF con el siguiente UUID: 77ceaca9-5678-43ab-b805-c0bab95cd69d.  The University Centre in Svalbard publica este recurso y está registrado en GBIF como un publicador de datos avalado por GBIF Norway.

Palabras clave

Samplingevent; Observation

Contactos

Cobertura geográfica

Samples were taken in fjords in Western and Northern Svalbard. Station IsK in Isfjorden (78.32N 15.16E) is the main station with monthly samples. Seasonal samples were taken at station KB3 in Kongsfjorden (78.95N 11.93E) and BAB in Billefjorden (78.65N 16.67N), as well as one time samples taken at R3 in Rijpfjorden (80.26N 22.29E), WF in Wijdefjorden (79.12N 16.04E) and on the Shelf west of Svalbard (79.55N 9.58E)

Cobertura taxonómica

All Calanus finmarchicus and Calanus glacialis were identified to species genetically.

Cobertura temporal

Métodos de muestreo

Calanus were collected with a bongo net (180µm mesh size, 2x 0.2728m2 opening) from the whole water column. In cases of bad weather and the need for manual labour to pull the net, a WP2 net (200µm mesh size, 0.25m2 opening) was used instead. In September samples were taken with a bongo net from the upper 50 meters, and the deepest 50-125 meters with a closing WP2-net (60µm mesh size, 0.25m2 opening) instead of the whole water column. Additional females were collected from 50-0 meters in April, May and June for egg incubation.

Descripción de la metodología paso a paso:

1. Photographing Calanus spp.: The samples with live Calanus spp. were filtered down to a known volume and then sub samples were taken with a stempel pipette. Each individual Calanus spp. from the subsample was picked out with a plastic pipette and placed individually on the inside of the lid of a 24 multi-vial tray. They were then photographed in lateral view and were forced into this position by removing some of the water surrounding it with a glass pipette. The pictures were taken with a Leica MC170 HD camera (Leica Microsystems) attached to a Leica MZ16, MZ9.5 or M205 C stereo microscope (Leica Microsystems) through the software LAS EZ, or LAS 4.6 (Leica Microsystems) for the Leica M205 C stereo microscope. The developmental stage was identified. Then the Calanus spp. were picked up with a pair of soft tweezers and dipped in distilled water and placed in either a pre-weighed tin cup in a flat bottomed 96-well plate or directly in 96-well PCR plate. When the work was finished and during breaks, the 96-well plates were frozen at -20∘C, and the samples were kept cold while working. To have a bigger non-quantitative dataset on the measurements for some developmental stages extra individuals were picked out, photographed and frozen.
2. Description of measurements taken: The individuals in tin cups were later freeze-dried in a FreeZone Benchtop Freeze Dryer, for approximately 24 hours. They were then put in a desiccator for at least one hour, and then every cup was weighed on a Microbalance XPR scale (accuracy ±0.5 μg) to give the dry weight of each individual copepod. The tin cups had been pre-weighted on the same scale. The computer program IMAGEJ (Schneider et al., 2012) was used to measure the area of the lipid sack and the prosome, and the prosome length. The areas were calculated by the program after drawing around the outline of the prosome and lipid sack with a drawing board (Intuos Pen and Touch Medium Tablet (CTH680), Wacom). The length was measured by drawing a line from the anterior to the posterior end of the prosome. IMAGEJ measures the numbers of pixels within the area or along the line. Before measuring, this was calibrated with a picture of a calibration slide, so the ratio for the number of pixels per mm was known. Because of the size variation between the different developmental stages, the pictures were taken on different magnifications on the microscopes, and a picture of the calibration slide was taken for each magnification used. The pictures have been taken with several combinations of microscopes and computers, and have different qualities, and therefore different numbers of pixels. For each sample new pictures of the calibration slide were taken. The degree of antenna pigmentation is given in three categories based on the percentage of redness on the antenna. The categories are “0% pigmentation, “<50% pigmentation” and “>50% pigmentation”.
3. Genetic species identification: The species identity of C. finmarchicus and C. glacialis was determined genetically. DNA was extracted using the HotSHOT-method (Montero-Pau et al., 2008), modified for working on Calanus. One copepod was added to each well of a 96 well PCR plate. To each well 100 μL of Lysis buffer (25 mM NaOH, 0.2 mM Na2EDTA) was added, before covering the plate with PCR strip caps, and incubating it in a PCR machine (Mastercycler X50s, Eppendorf) for 1 hour at 95 ∘C. After cooling down the plate for five to ten minutes, 100 μL of Neutralization solution (40 mM Trizma hydrochloride (Sigma-Aldrich)) was added to each well, and the plate was briefly centrifuged (Centrifuge 5804, Eppendorf) at 1000 rpm to make sure all material was at the bottom of the well. Lysis buffer and Neutralization solution were in addition added to a well without a copepod as a negative control for the DNA extraction. In cases where the copepod had first been placed in a tin cup for weighing, each individual was moved using soft tweezers that was cleaned with 10% sodium hypochlorite (NaOCl, household bleach) between every single copepod to avoid cross-contamination. The tweezers were wet after being rinsed off with Milli-Q water, and the lysis buffer was already added to the well of the PCR-plate, so the copepod easily let go of the tweezers when being put in the well. 75 μL of Lysis buffer and Neutralization solution was added to wells containing a copepod of developmental stage CI - CIII to ensure high enough concentration of DNA. A master mix containing everything except the DNA sample was made to keep PCR conditions consistent between reactions. The master mix was pipetted into each well of a 96 well PCR plate prior to adding DNA or controls. Each reaction contained 1.085 μL Milli-Q Water, 0.06 μL Forward Primer, (G-150F, GACGCCATTGACCATCCAGT, 10 μM), 0.06 μL Reverse Primer (G-150R, GCTCCAGCGGTTAGGTTTCT, 10 μM), 2.5 μL AccuStart II PCR ToughMix (Quantabio), 0.025 μL 6x Orange DNA loading dye (Thermo Scientific), 0.02 μL MgCl2 (25mM, Roche), and 1.25 μL of extracted DNA. The process was controlled by the incorporation of positive and negative controls during every PCR amplification. DNA from a C. finmarchicus and C. glacialis (1.25 μL each) was added as positive PCR controls, while 1.25 μL Milli-Q water was used as a negative PCR control. An extraction blank, 1.25 μL of Lysis buffer and Neutralization solution mix, was used as negative control for the DNA extraction. After covering the plate with adhesive film or PCR strip caps and giving it a quick spin in the plate centrifuge to make sure all the liquid was collected at the bottom of the well. PCR was carried out in the PCR machine. First, the program ran 2 minutes at 94°C, then 35 cycles of 10 seconds at 94°C, 10 seconds at 55°C and 10 seconds at 72°C, and finally 5 minutes at 72°C. The products were kept cool at 10°C in the machine until collection. The PCR-products were analysed by gel electrophoresis on a 2% gel in 1X TAE buffer stained with 3.5 μL of GelRed Nucleic Acid Stain (Biotium). In the first and last well of each row 2μL DNA ladder (GeneRuler Low Range DNA Ladder, Thermo Scientific or MassRuler Low Range DNA Ladder, Thermo Scientific) was added. The second well of each row had 1.5 μL positive control, either C. finmarchicus or C. glacialis. In the remaining wells I added 2 μL of the PCR-products or the negative controls. The gel ran for 20 minutes at 220 V, before photographing the gel under UV-light (NuGenius, Syngene), to see the position of the DNA-bands in the gel. The expected amplicon size using G-150F and G-150R primers is 131 base pairs for C. finmarchicus and 161 base pairs for C. glacialis (Smolina et al., 2014), allowing clear discrimination of the two species on a 2% agarose gel.
4. Measuring egg production rate: The live samples from the upper 50 meters sampled in April and May were used for capturing females for incubation to measure egg production rate. At IsK in mid-June the sample taken from the whole water column was used, due to the net being pulled by manual labour. The female Calanus were placed individually in their own egg incubation chambers. The chambers consisted of two plastic cups stacked into each other, where the upper one had the bottom replaced with a mesh, with empty space below. If the females laid eggs, the eggs would sink and pass through the mesh, avoiding predation by the female. The chambers were filled with filtered sea water and a lid was loosely placed on top. Temperatures were as close to in situ as possible. The females were in the egg incubation chambers for 24 hours and were then removed. They were then photographed and placed in tin cups for weighing and genetic identification like mentioned above. The eggs within each cup were counted.

Referencias bibliográficas

1. Montero-Pau, Javier, Africa Gómez, and Joaquín Muñoz. 2008. ‘Application of an Inexpensive and High-Throughput Genomic DNA Extraction Method for the Molecular Ecology of Zooplanktonic Diapausing Eggs’. Limnology and Oceanography: Methods 6 (6): 218–22. https://doi.org/10.4319/lom.2008.6.218. https://doi.org/10.4319/lom.2008.6.218.
2. Schneider, Caroline A., Wayne S. Rasband, and Kevin W. Eliceiri. 2012. ‘NIH Image to ImageJ: 25 Years of Image Analysis’. Nature Methods 9 (7): 671–75. https://doi.org/10.1038/nmeth.2089. https://doi.org/10.1038/nmeth.2089.
3. Smolina, I., S. Kollias, M. Poortvliet, et al. 2014. ‘Genome- and Transcriptome-Assisted Development of Nuclear Insertion/Deletion Markers for Calanus Species (Copepoda: Calanoida) Identification’. Molecular Ecology Resources 14 (5): 1072–79. https://doi.org/10.1111/1755-0998.12241. https://doi.org/10.1111/1755-0998.12241.

Metadatos adicionales